Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
hsa-mir-506      -UCAGCCAUACUAUGUGUAGUGCCUUAUUCAGGAAGGUGUUACUUAAUAGAU-UAAUAUU
hsa-mir-507      --CCGCUGUGCUGUGUGUAGUGCUUCACUUCAAGAAGUGCCAUGCAUGUGUCUAGAAAUA
hsa-mir-510      -U----GUGUAUGUGUGUGGUGUCCUACUCAGGAGAGUGGCAAUCACAUGUAAUUAGGUG
hsa-mir-514-1    --UAAACAUGUUGUCUGUGGUACCCUACUCUGGAGAGUGACAAUCAUGUAUAAUUAAAUU
hsa-mir-514-2    --UAAACAUGUUGUCUGUGGUACCCUACUCUGGAGAGUGACAAUCAUGUAUAACUAAAUU
hsa-mir-514-3    --UAAACAUGUUGUCUGUGGUACCCUACUCUGGAGAGUGACAAUCAUGUAUAACUAAAUU
hsa-mir-888      -----CCAUGUUGUGGGCAGUGCUCUACUCAAAAAGCUGUCAGUCACUUAGA-UUACAUG
hsa-mir-890      -----ACAUGCUGUGGGAAGUGCCCUACUUGGAAAGGCAUCAGUUGCUUAGA-UUACAUG
hsa-mir-892a     AUCAGCCAUGCUGUGGGCAGUGCCUUACUCAGAAAGGUGCCAGUCACUUACAC-UACAUG
hsa-mir-892b     -UCAGCCAUGCUGUGUGCAAUGCCCUACUCAGAAAGGUGCCAUUUAUGUAGAU-UUUAUG
CONS STRUCTURE   .............(((((..(((.((((((.((.(((.(.(((((((((........)))

hsa-mir-506      UGUAAGGCACCCUUCUGAGUAGAGUAAUGUGCAACAUGGACAA----
hsa-mir-507      UGUUUUGCACCUUUUGGAGUGAAAUAAUGCACAACAGAUACAA----
hsa-mir-510      UGAUUGAAACCUCUAAGAGUGGAGUAACACAUGACAUGUACUAC-AU
hsa-mir-514-1    UGAUUGACACUUCUGUGAGUAGAGUAACGCAUGACACGUACGA----
hsa-mir-514-2    UGAUUGACACUUCUGUGAGUAGAGUAACGCAUGACACUUACGA----
hsa-mir-514-3    UGAUUGACACUUCUGUGAGUAGAGUAACGCAUGACACUUACGA----
hsa-mir-888      UGACUGACACCUCUUUGGGUGAAGGAAGGCUCACCAAGUACACUUUU
hsa-mir-890      UAACUAUUCCCUUUCUGAGUAGAGUAAGUCUUACCAAGUACAAGUUC
hsa-mir-892a     UCACUGUGUCCUUUCUGCGUAGAGUAAGGCUCACUAAGUACA-----
hsa-mir-892b     UCACUGGCUCCUUUCUGGGUAGAGCAAGGCUCACCAUGUAUAU----
CONS STRUCTURE   )))))).).))).)).)))))).)))..)))))..............



Consensus
CPU time: 0.00
Average sequence ID: 0.6169527897
Average free energy: -16.81
Average covariation: 0.157567049808
Average basepair probability: 0.743815747342
Canonical basepairs: NA

Sequence and structure consensus for Consensus
auYARMCAUGYUGUSKGYRGURCCCUACUCAGRARRGUGMCARUCAYKURKAAYUAMAUKUSAYUGRCACCUYUSUGAGURGAGUAASGC WYRMCAMGUACRAbuwy
.............(((((..(((.((((((.((.(((.(.(((((((((........))))))))).).))).)).)))))).)))..)) )))..............

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table