Results

You can download the results in the following formats: fasta clustal stockholm col
CMfinder
CPU time: 11.28
Average sequence ID: 0.986798679868
Average free energy: -58.1
Average covariation: -0.132882882883
Average basepair probability: 0.908253108608
Canonical basepairs: NA

Sequence and structure consensus for CMfinder
CRCACCCGGCUGUGUGCACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCAGGGCCC GGGACAGCGCC
(((.(((((((.((.((((((((((.((.(((.((((...(((((.(....).)).))).))))))).)).)))))))))).)).))).) )))...)))..

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table