Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
hsa-mir-154      ------UAGCGUGUG-GUACU-UGAAGAUAGGUUAUCCGUGUUGCCUUCG--CU-UUAUU
hsa-mir-300      -C----CAUCAUU-UGCUACU-UGAAGAGAGGUAAUCCUUCACGCAUUUG--CU-UUACU
hsa-mir-329-1    -G---UUAAUCAGUG-GUACC-UGAAGAGAGGUUUUCUGGGUUUCUGUUU--CU-UUAAU
hsa-mir-329-2    -G---UUACUUGGUG-GUACC-UGAAGAGAGGUUUUCUGGGUUUCUGUUU--CU-UUAUU
hsa-mir-376a-1   ------CCUUCUUUG-GUAUU-UAAAAGGUAGAUUCUCCUUCUAUGAGUA--CA-UUAUU
hsa-mir-376a-2   -AA--ACCUUCUUUG-GUAUU-UAAAAGGUAGAUUUUCCUUCUAUGGUUA--CG-UGUUU
hsa-mir-376b     --G--UCCUUCUUUG-GUAUU-UAAAACGUGGAUAUUCCUUCUAUGUUUA--CG-UGAUU
hsa-mir-376c     -AA--UCCUUCUUUG-GUAUU-UAAAAGGUGGAUAUUCCUUCUAUGUUUA--UG-UUAUU
hsa-mir-377      -----CUGAUGUUUG-ACCCU-UGAGCAGAGGUUGCCCUUGGUGAAUUCG--CU-UUAUU
hsa-mir-379      --------UUCCGUGGUUCCU-GAAGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGAUU
hsa-mir-381      -----CUAUUGUUUG-GUACU-UAAAGCGAGGUUGCCCUUUGUAUAUUCG--GU-UUAUU
hsa-mir-382      ------UUUUCUGUG-GUACU-UGAAGAGAAGUUGUUCGUGGUGGAUUCG--CU-UUACU
hsa-mir-410      -AU-GG-CACUCUGG-GUACC-UGAGAAGAGGUUGUCUGUGAUGAGUUCG--CUUUUAUU
hsa-mir-411      --------CUGUGUGGUACUU-GGAGAGAUAGUAGACCGUAUAGCGUACG--CU-UUAUC
hsa-mir-487a     -CG--UCAGCCUUCG-GUACU-UGAAGAGUGGUUAUCCCUGCUGUGUUCG--CU-UAAUU
hsa-mir-487b     -UG--CUAACCUUUG-GUACU-UGGAGAGUGGUUAUCCCUGUCCUGUUCG--UU-UUGCU
hsa-mir-494      -GU-GCUAAUCUUCG-AUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCU--CU-UUAUU
hsa-mir-495      -UG--CUCAUCUCUG-GUACC-UGAAAAGAAGUUGCCCAUGUUAUUUUCG--CU-UUAUA
hsa-mir-496      -AGCACCCAAGUCAG-GUACU-CGAAUGGAGGUUGUCCAUGGUGUGUUCA--UU-UUAUU
hsa-mir-539      UG---CUGCUGUUUC-AUACU-UGAGGAGAAAUUAUCCUUGGUGUGUUCG--CU-UUAUU
hsa-mir-543      -UG--CUGACGUGCG-GUACU-UAAUGAGAAGUUGCCCGUGUUUUUUUCG--CU-UUAUU
hsa-mir-655      -A---CUAUGCAAGG-AUAUU-UGAGGAGAGGUUAUCCGUGUUAUGUUCG--CU-UCAUU
hsa-mir-656      AGU-GCUGCUCAGU-GGUACC-UGAA-AUAGGUUGCCUGUGAGGUGUUCA--CU-UUCUA
hsa-mir-758      CAG-CA-CGUGCCUGGAUACA-UGA--GAUGGUUGACCAGAGAGCACACG--CU-UUAUU
hsa-mir-889      -C--ACAGUUCUUUG-GUGCU-UAAAGAAUGGCUGUCCGUAGUAUGGUCU--CU-AUAUU
CONS STRUCTURE   ..............(.(((((..((((((((((((((((((....(((((..........

hsa-mir-154      UGUGACGAAUCAUACACGGUUGACCUAUUUUUCAGUACCAAAUCCCGCC--UUG
hsa-mir-300      UGCAAUG-AUUAUACAAGGGCAGACUCUCUCUGGGGAGCAAAUCCUGCC--UGG
hsa-mir-329-1    GAGGACGAAACACACCUGGUUAACCUCUUUUCCAGUAUCAAAUCCCAUC----U
hsa-mir-329-2    GAGGACGAAACACACCUGGUUAACCUCUUUUCCAGUAUCAAAUCCCAUC----U
hsa-mir-376a-1   UAUGAUUAAUCAUAGAGGAAAAUCCACGUUUUCAGUAUCAAAUGCUGCU--UUG
hsa-mir-376a-2   GAUGGUUAAUCAUAGAGGAAAAUCCACGUUUUCAGUAUCAAAUGCUGCC-----
hsa-mir-376b     CCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUCAAAUGCUGCU----U
hsa-mir-376c     UAUGGUUAAACAUAGAGGAAAUUCCACGUUUUCAGUAUCAAAUGCUGCU-----
hsa-mir-377      UAUGUUGAAUCACACAAAGGCAACUUUUGUUUGAGUAUCAAAUCCUGCU---UG
hsa-mir-379      UCUGACCUAUGUAACAUGGUCCACUAACU-CUCAGUAUCCAAUCCAUCCUC---
hsa-mir-381      GACAUGGAAU-AUACAAGGGCAAGCUCUCUGUGAGUAUCAAACCUUGUC--UUG
hsa-mir-382      UAUGACGAAUCAUUCACGGACAACACUUUUUUCAGUACCAAAUGCUACC--UCU
hsa-mir-410      AAUGACGAAUAUAACACAGAUGGCCUGUUUUC-AGUACCGCUACCGCCC-----
hsa-mir-411      UGUGACGUAUGUAACACGGUCCACUAACC-CUCAGUAUCAAAUCCAUCCCCGAG
hsa-mir-487a     UAUGACGAAUCAUACAGGGACAUCCAGUUUUUCAGUAUCAAAUACUGCU-----
hsa-mir-487b     CAUGUCGAAUCGUACAGGGUCAUCCACUUUUUCAGUAUCAAGAGC-GCA----G
hsa-mir-494      UAUGAUGAAACAUACACGGGAAACCUCUUUUUUAGUAUCAAAUCCCA-------
hsa-mir-495      UGUGACGAAACAAACAUGGUGCACUUCUUUUUCGGUAUCAAAUAUCUCC-----
hsa-mir-496      UAUGAUGAGUAUUACAUGGCCAAUCUCCUU-UCGGUACUCAAUUCUUC------
hsa-mir-539      UAUGAUGAAUCAUACAAGGACAAUUUCUUUUUGAGUAUCAAAUCUUGCC-----
hsa-mir-543      UGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGUAUCCUAUUCUGCC-----
hsa-mir-655      CAUCAUGAAUAAUACAUGGUUAACCUCUUUUUGAAUAUCAGACUCUGCC----U
hsa-mir-656      UAUGAUGAAUAUUAUACAGUCAACCUCUU-UCCGAUAUCGAAUCCCAC-----C
hsa-mir-758      UGUGCCGUUUGUGACCUGGUCCACUAAC-CCUCAGUAUCUAAUGCCCCC----U
hsa-mir-889      UAUGAUGAUUAAUAU-CGGACAACCAUUGUUUUAGUAUCCAAAUUUGCU----U
CONS STRUCTURE   .....)))))....)))))))))))))))))).))))))...............



Consensus
CPU time: 0.00
Average sequence ID: 0.555744054288
Average free energy: -21.0552
Average covariation: 0.237126436782
Average basepair probability: 0.722648326132
Canonical basepairs: NA

Sequence and structure consensus for Consensus
mRgcrCYVWYSUKUGgGUACUcURARRRGWRGUURYCCSUGKURYGUUCGcgCUwUUAUUURUGAYGAAUCAUACASGGWCAACCWCUUU UUSAGUAUCAAAUSCYGCCycuuK
..............(.(((((..((((((((((((((((((....(((((...............)))))....)))))))))))))))) )).))))))...............

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table