Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
mir-130b         CACUGGC-AGGCCUGCC-CGACACUCUUUCCCUGU-UGCACUACUA-UAGGCCGCUGGGA
mir-181a-1       GUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUG-UCGGUGAGUUU-GGAAUUAAAAUCA
mir-181a-2       GCCUUCAGAGGACUCCAAGGAACAUUCAACGCUG-UCGGU-GAGUU-UGGGAUUUGAAAA
mir-181b-1       UUUUUUAAAAGGUCACAAUCAACAUUCAUUGCUG-UCGGUGGGUU--GAACUGUGUGGAC
mir-181b-2       AAACACUGAUGGCUGCACUCAACAUUCAUUGCUG-UCGGUG-GGUU-UGA-GUCUGAAUC
mir-181c         AUUUGCCAAGGGUUUGGGGGAACAUUCAACC-UG-UCGGUGAGUUU-GGGCAGCUCAGGC
mir-181d         CCACAGCCGAGGUCACAAUCAACAUUCAUUGUUG-UCGGUGGGUUGUGAGGACUGAGGCC
mir-30a          UGCUGUUGACAGUGAGCGACUGUAAACAUCCUCGA-CUGGAAGCUGUGAAGCCA-CAGAU
mir-30b          UUAAACCAAGUUUCAGUUCAUGUAAACAUCC-UA--CACUCAGCU-GUAAUACAUG-GAU
mir-30c-1        UAUAACCAUGCUGUAGUGUGUGUAAACAUCCUACA-CUCUCAGCUG--UGAGCUCAAG-G
mir-30c-2        GAGCACUGAGCGACAGAUACUGUAAACAUCCUACA-CUCUCAGCUGUGGAAA-GUAAG-A
mir-30d          UUGUUCAGAAAGUCUGUUGUUGUAAACAUCCCCGA-CUGGAAGCUG-UAAGACA-CAGCU
mir-30e          UUCUGGGCAGUCUUUGCUACUGUAAACAUCCUUGA-CUGGAAGCUGUAAGGUGUUCAGAG
mir-500          UGUGUUCUGCUCCCCCUCUC-UAAUCCUUGCUACCUGGGU-GAGAGUGCUGUCUGAAUGC
CONS STRUCTURE   ............((((((.((((((((((((..(..(((((((((...............

mir-130b         AGCAGUGCAAUGAUGAAAGGGCAUCG-GUCAGGUCCAGCCUGCUAC-
mir-181a-1       A-AAC-CAUCGACCGUUGAUUGUA-CCCUAUGGCU-AACCAUCAUCU
mir-181a-2       A-AC--CACUGACCGUUGACUGUACCUUGGGGUCCUUACAGACGACA
mir-181b-1       A-AGCUCACUGAACAAUGAAUGCA-AC-UGUGGCCCCGCUUUUUGCU
mir-181b-2       A-AC-UCACUGAUCAAUGAAUGCAAACUGCGGACCAAACAACCCAAA
mir-181c         A-AA-CCAUCGACCGUUGAGUGGACCCUGAGGCCUGGAAUUGCCAU-
mir-181d         A-GACCCACCGGGGGAUGAAUGUC-AC-UGUGGCUGG--GCCAGACA
mir-30a          G-GGCUUUCAGUCGGAUGUUUGCAGCUGCCUACU--GCC-UCGGACU
mir-30b          U-GGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGAAUGUCAACC
mir-30c-1        U-GGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGAA-AACAUCA
mir-30c-2        A-AGCUGGGAGAAGGCUGUUUACUCUUUCUGCCUUGGAA-GUCAAC-
mir-30d          A-AGCUUUCAGUCAGAUGUUUGCUGCUACCGGCUA-UUCA-CAGACA
mir-30e          G-AGCUUUCAGUCGGAUGUUUACAGCGGC--AGGCUGCC-ACGGUC-
mir-500          A-AUG-CACCUGGGCAAGGAUUCUGAGAGCGAGAGCUUC-AUCUUC-
CONS STRUCTURE   ..))))))))).))))))))))))).))))))...............



Consensus
CPU time: 0.00
Average sequence ID: 0.38132132761
Average free energy: -18.4564285714
Average covariation: 0.355720172684
Average basepair probability: 0.720191324018
Canonical basepairs: NA

Sequence and structure consensus for Consensus
UWYUDSMRAGKGYYWSWKUSWRYAWWCAUCSYUGAUCKSUVRGYUKuKRRGWCWUMAGMMAgRRCUSACMGRCSGWUGWWURCWSMYKBC KRSYYSGAMWWYCRWCW
............((((((.((((((((((((..(..(((((((((.................))))))))).))))))))))))).)))) ))...............

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table