Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
mir-101-1        ACUG---A-CAGG-CUGCC--CUGGCU-CAGUUAUCACAGUGCUGAUGC-UGUCUAUUCU
mir-101-2        AUAUGAG-ACUGA-ACUGUC-CUU-UUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGA
mir-105-1        AAC----CUGAGUGUGCAUCG---UGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAU
mir-105-2        CUU----CUGUGUGUGCAUCG---UGGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUUAU
mir-138-1        CUGG---CAUGGUGUGGUGGGG--CAG-CUGGUGUUGUGAAUCAGGCCGUUGCCAAUCAG
mir-146a         CC-G---A-UGUG-UAUCC--UCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGU
mir-190          CUUU---UCUGCA-GGCCU--CUGUGU-GAUAUGUUUGAUAUAUUAGGUUG-UUAUUUAA
mir-190b         CUCU---CCUGCC-UGCUU--CUGUGU-GAUAUGUUUGAUAUUGGGUU-GUUUAAUUAGG
mir-200a         CCCU--CCCGGGCC-CCUG--UGAGCA--UCUUACCGGACAGUGCUGGAUUUCCCAGCUU
mir-200b         CCAG---C-UCGGGCAG--CCGU-GGC-CAUCUUACUGGGCAGCAUUGGAUGGAGUCAGG
mir-208b         CCCCACC-UCCUU-CUCCUC-UCA-GGGAAGCUUUUUGCUCGAAUUAUGUUUCUGAUC-C
mir-429          CCACACCACCGCCGGC--CG-AUGG--GCGUCUUACCAGACAUGGUUAGACCUGGCCCUC
mir-489          UGCU---GUUGGUGGCAGCUU-G-GUG-GUCGUAUGUGUGACGCCAUUUACUUGAACCUU
mir-545          GCC----UGGCACAUUAGU--AGGC-C-UCAGUAAAUGUUUAUUAGAUGAAUAAAUGAAU
mir-567          GAAGA-G--GAUU-CUUAUA-GGA-C--AGUAUGUUCUUCCAGGACAGAACAUUCUUUGC
mir-9-1          GGAGG-C--GGGG-UUGGUU-GUU-AUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAG
mir-9-2          GUGUG-G--GAAG-CGAGUU-GUU-AUCUUUGGUUAUCUAGCUGUAUGAGU-GUAUUGGU
mir-9-3          CUAAG-G--GAGG-CCCGUU-UCU-CUCUUUGGUUAUCUAGCUGUAUGAGUGCCACAGAG
CONS STRUCTURE   ............................(((((((((((((...((((((..........

mir-101-1        AAAGGUACAGUACUGUGAUAACUGAA-GGAUGGCAGCCAUCUUACCUUCCA
mir-101-2        AAGGUAC-AGUACUGUGAUAACUGAAGAAUGGUGGU-GC-CAU---CACAU
mir-105-1        GCACCACGGAUGUUUGAGCAUGUGC-UACGGUGUCUAC-UU-UUGCUACAU
mir-105-2        GCACCACGGAUGUUUGAGCAUGUGC-UAUGGUGUCUAC-UU-UUGCAACAU
mir-138-1        AGAACGGCUACUUCACAACAC-CAGGGCCACACCACAC-UACA-GGCA-GC
mir-146a         CAGACCUCUGAAAUUCAGUUCUUCA-GCUGG-GAUAUCUCUGUCAUCGUGG
mir-190          UCCAACUA-UAUAUCAAACAUAUUCCUACAGUGUCUUG-CCCUGUCUCCGG
mir-190b         AACCAACUAAAUGUCAAACAUAUUCUUACAGCAGCAGG-UG-AUUCAGCAC
mir-200a         GACUCUAACACUGUCUGGUAACGAUG-UUCAAAGGUGA-CCCGCC-GCUCG
mir-200b         UCUCUAAUACUGCCUGGUAAUGAUGA-CGGCGGAGCCC-UGCACGCAGCGA
mir-208b         GAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCAGA-G-UG---CUUCCG
mir-429          UGUCUAAUACUGUCUGGUAAAACCGU-CCAUCCGCUGC-CU--GAU-CACC
mir-489          UAGGAGUGACAUCACAUAUACGGCAGCUAAACUGCUAC--AUG-GGA-CAA
mir-545          GACUCAUCAGCAAACAUUUAUUGUGUGCCUGCUAAAGU-G-AGCUCCACAG
mir-567          UAUUUUGUACUGGAAGAACAUGC-AAAACUAAAAAAAAAAAAAGU-UAUUG
mir-9-1          UCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACC-C-C-AUA-CACUG
mir-9-2          CU-UCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCU-U-CAAGAUCGCCG
mir-9-3          CCGUCAUAAAGCUAGAUAACCGAA-AGUAGAAAUGAUUC-UCA--CAACUU
CONS STRUCTURE   ..))))))...)))))))))))))...........................



Consensus
CPU time: 0.00
Average sequence ID: 0.257365473582
Average free energy: -15.6611111111
Average covariation: 0.945046439628
Average basepair probability: 0.800187938144
Canonical basepairs: NA

Sequence and structure consensus for Consensus
CYMKrmsMYKRGKgYSCSYYgSKDKSKYYWURUDUYUGDAMMYSKRUGRWKKYURWUYRKKMMYCAWMAAUGUWSRRAHAYGUWVRKMMR RMGRMWACmYYMWBRCHACMG
............................(((((((((((((...((((((............))))))...)))))))))))))...... .....................

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table