Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
mir-103-1        GGAAGUUUUCUUACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAA-
mir-103-2        GAGCUGCGUCUUUGUGCUUUCAGCUUCUUUACAGUGCUGCCUUGUAGCAUUCAGGUCAA-
mir-107          UUCGAUAUUCUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAA-
mir-217          AU-AGUUUUUGAUGUCGCAGAUACUGCAU-CAGGAACUGAUUGGAUAAGAAUCAGUCACC
mir-660          AU-GAACUGCUCCUUCUCCCAUACCCAUU-GCAUAUCGGAGUUGUGAAUUCUCAAAACAC
CONS STRUCTURE   ........((((((((((((..((.(((.(((((((((((.(((............))).

mir-103-1        -GCAGCAUUGUACAGGGCUAUGAAGGCAUUGA-GACCUGUUC--UU
mir-103-2        -GCAGCAUUGUACAGGGCUAUGAAAGAACCAA-GAAUGGGCU--GC
mir-107          -GCAGCAUUGUACAGGGCUAUCAAAGCACAGA-GAGCUUGCU--AC
mir-217          AUCAGUUCC-UAAUGCAUU-GCCUUCAGCAUCUAA-ACAAGCACCA
mir-660          CUCCUGUGU-GC-AUGGAUUACAGGAGGGUGA-GCCUUGUCAUCGU
CONS STRUCTURE   .))))))))))).)))))....)))))))))).))...........



Consensus
CPU time: 0.00
Average sequence ID: 0.426371511068
Average free energy: -21.698
Average covariation: 0.401612903226
Average basepair probability: 0.768919628374
Canonical basepairs: NA

Sequence and structure consensus for Consensus
RUVRRUYUUCUYUSUSCYYUMWRCUUCUUUACAGWGCUGMCUUGUKRMAUAUMRRUCAAcmKCAGCWUUGUAMAGGGCUAUSAARGMRCW GAuGAVYUGKCYwcGY
........((((((((((((..((.(((.(((((((((((.(((............)))..))))))))))).)))))....)))))))) )).))...........

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table