Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
hsa-let-7a-1     A-UGUUCUCUUCACUGUGGGAUGAGGUAGUAGGUUGUAUAGUUU-UAGGGUCA--CA---
hsa-let-7a-3     A-GACCGACUGCCCUUUGGGGUGAGGUAGUAGGUUGUAUAGUUU-GGGGCUC---UG---
hsa-let-7b       C-AAGGCCGGGCCUGGCGGGGUGAGGUAGUAGGUUGUGUGGUUU-CAGGGCAGUGAUGUU
hsa-let-7d       A-AAAAAAUGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUU-UAGGGCAGGGAUUUU
hsa-let-7f-1     A-AAACAUUGCUCUAUCAGAGUGAGGUAGUAGAUUGUAUAGUUG-UGGGGUAGUGAUUUU
hsa-let-7f-2     GACACUGG-UGCUCUGUGGGAUGAGGUAGUAGAUUGUAUAGUUU-UAGGGUCA--UA---
hsa-let-7g       C-CUUUUGCCUGAUUCCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACC
hsa-let-7i       C-CCGACACCAUGGCCCUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAUU
hsa-mir-98       G-GAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUG-UGGGGUAGGGAUAUU
CONS STRUCTURE   ................(((((.(((((((((((((((((((((....(((..........

hsa-let-7a-1     ---CCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUAACG-UGA--
hsa-let-7a-3     ----CCCU-GCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCUGAAGUGGCUG
hsa-let-7b       --GCCCC---UCGGAAGAUAACUAUACAACCUACUGCCUUCCCUGAGG------
hsa-let-7d       --GCCCA---CAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGGG------
hsa-let-7f-1     --ACCCU-GUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGA--------
hsa-let-7f-2     ---CCCCA-UCUUGGAGAUAACUAUACAGUCUACUGUCUUUCCCACGGUGGU--
hsa-let-7g       --ACCCG-GUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAG---------
hsa-let-7i       --GCCCG-CUGU-GGAGAUAACUGCGCAAGCUACUGCCUUGCUAGU--------
hsa-mir-98       AGGCCCC-AAUUAGAAGAUAACUAUACAACUUACUACUUUCCCU----------
CONS STRUCTURE   ...))).............)))))))))))))))))))))))))).........



Consensus
CPU time: 0.00
Average sequence ID: 0.589958158996
Average free energy: -32.7511111111
Average covariation: 0.239703065134
Average basepair probability: 0.876388390239
Canonical basepairs: NA

Sequence and structure consensus for Consensus
MaMAYYCWCBKCMYYSYRGGVUGAGGUAGUAGGUUGUAYAGUUKgURGGGYMRKGAUWUUagRCCCChSWYYAGGAGAUAACUAUACAAY CUACUGYCUUYCCURASGukghug
................(((((.(((((((((((((((((((((....(((.............))).............))))))))))) ))))))))))))))).........

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table