Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
hsa-mir-122      -GA--GUUUCCUUA-GCAG-AGCUGUGGAGUGUGACAAUGGUGUU-UG-UGUCUAAACU-
hsa-mir-32       UCU-GCUUGC-UCU-GGUGGAGAUAUUGCACAUUACUAAGUUGCA-UGUUGUCACGGCC-
hsa-mir-549      AGACAUGCAACUCAAGAAUAUAUUGAGAGCUCAUCCAUAGUUGUC-ACUGUCUCAA-AU-
hsa-mir-552      AACCAUUCAA-AUA-UACCACAGUUUGUUUAACCUUUUGCCUGUU-GGUUGAAGAUGCC-
hsa-mir-559      GA-UG-AGCUC-CAGUAACAUCUUAAAGUAAAUAUGCACCAAAAU-UACUUUUGGUAAA-
hsa-mir-561      UUCAUCCACC-AGU-CCUCCAGGAACAUCAAGGAUCUUAAACUUU-GCCAGAGCUACAA-
hsa-mir-577      --G-UAUU-UGGG--GGAGUGAAGAGUAGAUAAAAUAUUGGUACC-UGAUGAAUCUGAG-
hsa-mir-579      AUUAG-GUUA-AUG-CAAAAGUAAUCGCGGUUUGUG-CCAGAUGACGAUUUGAAUUAAU-
hsa-mir-580      UA-AA-AUUUC-CAAUUGGAACCUAAUGAUUCAUCAGACUCAGAU-A-UUUAAGUUAAC-
hsa-mir-586      -AA--GACAUGGGGU--AAAACCAUUAUGCAUUGUAUUUUU-AGG-UCCCAAUACAUGU-
hsa-mir-605      -C-UC-U-AGC-CCUAG-CUUGGUUCUAAAUCCCAUGGUGCCUUC-UCCUUGGGAAAAA-
hsa-mir-606      -----------UGUAUCCUUGGUUUUUAGUAGUUUUACUAUGAUG-AGGUGUGC-CAUC-
hsa-mir-607      -UU-GCCUAA-AGU-CACACAGGUUAUAGAUCUGGAUUGGAACCC-AGGGAGCCAGACU-
hsa-mir-609      CAUG-CUGCUC-GG-CUGUUCCUAGGGUGUUUCUCUCAUCUCUGGUCUAUAAUGGGUUA-
hsa-mir-610      AU-UU-GUCUA-UUUGUC-UUAGGUGAGCUAAAUGUGUGCUGGGA-CACAUUUGAGC--C
hsa-mir-624      -UA--UAUAA-UGC-UGUUUCAAGGUAGUACCAGU-ACCUUGUGU-UCAGUGGAACCAA-
hsa-mir-625      GU-GG-U-AAG-GGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCC-UG-UAAUUAGAUC-
hsa-mir-627      UG-AA-UUACU-UAUUAC-UGGUAGUGAGUCUCUAAGAAAAGAGG-AGGUGGUUGUU--U
hsa-mir-629      CC-CU-UUCCC-AGGGG-AGGGGCUGGGUUUACGUUGGGAGAACU-UUUACGGUGAACC-
hsa-mir-642      -A---GUUUAU-CU-GAGUUGGGAGGGUCCCUCUCCAAAUGUGUCUUG-GGGUGGGGGA-
hsa-mir-934      -AA--CUUGA-GAA-AUAAGGCUUCUGUCUACUACUGGAGACACU-GG-UAGUAUAAAA-
hsa-mir-942      CA-GC-AAACA-UUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUG-UG-UACUCACAGCC
hsa-mir-944      A--UUUAUGUU-CC-AGACACAUCUCAUCUGAUAUACAAUAUUUU-CUUAAAUUGUAUA-
CONS STRUCTURE   ....................((((((((((((((((((((((((................

hsa-mir-122      AUCAA-ACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC------AAUCCUUCCC
hsa-mir-32       UCAA-UGCAAUUUAGUG-UGUGUGAUAUUUUC-ACAUGAGU-----GCAU-GC-AC
hsa-mir-549      CAGUGACAACUAU-GGAUGAGCUCUUAAUA-UAUCCCAGGC-----A-----CUGU
hsa-mir-552      UUUC-AACAGGUGACUGGUUAGACAAACUG-UGGUAUAUAC-----AC----AGGA
hsa-mir-559      U-ACAGUUUUGGUGCAUAUUUACUUUAGGAUGUU-ACUGGA-----GCUCCC---A
hsa-mir-561      AGGCA-AAGUUUAAGAUCCUUGAAGUUCCU-GGGGGAACCA-----UGG----AUG
hsa-mir-577      GC-CAGGUUUCAAUACUUUAUCUGCUCUUC-AUUUCCCCAU-----AUCUACUUAC
hsa-mir-579      AAAU--UCAUUUGGUAUAAACCGCGAUUAU-UUUUGCAUC------AACUUACUA-
hsa-mir-580      --AGUAUUUGAGAAUGAUGAAUCAUUAGGUUCCGGUCAGAA-----AUUUU--UCA
hsa-mir-586      GGG-CC-CUAAAAAUACAAUGCAUAAUGGUUUU-UCACUCU--UU-AUCUUCUUA-
hsa-mir-605      C-AGAGAAGGCACUAUGAGAUUUAGAAUCAAG-UUAGGACU-----GCAGAUACAG
hsa-mir-606      CACCCCAUCAUAGUA-AACUACUGAAAAUCAAAGAUACAAGUGCCUGACCACUUCU
hsa-mir-607      GCCUGGGUUCAAAU-CCAGAUCUAUAACUU-GUGUGACUUU-----GGG--CGAGU
hsa-mir-609      AAUAG-UAGAGAUGAGGGCAACACCCUAGG-AACAGCAGAG-----GAA----CCC
hsa-mir-610      AAAUGUCCCAGCACACAUUUAGCUCACAUAAGAAAAAUGGA-----C-UCU--AGU
hsa-mir-624      GGUA-AACACAAGGUAUUGGUAUUACCUUG-AGAUAGCAUU-----ACACCUAAGU
hsa-mir-625      --UCAGGACUAUAGAACUUUCCCCCUCAUCCCUCUGCC-CU-----CUACCAACUG
hsa-mir-627      UC-CUCCUCUUUUCUUUGAGACUCACUACCAAUAAUAAGAA-----AUACU--ACU
hsa-mir-629      A-GGAGGUUCUCCCAACGUAAGCCCAGCCCCU-CCCCUCUG-----CCUGCC--UC
hsa-mir-642      UCAAG-ACACAUUUGGAGAGGGAACCUCCC-AACUCGGCCU-----CUGCCAUCAU
hsa-mir-934      CC-CA-GAGUCUCCAGUAAUGGACGGGAGCCUUAUUUCUAU-----CACUCAGUGU
hsa-mir-942      CCUCACACAUGGCCGAAACAGAGAAGUUACUUUC-CUAAUA-----UUUGC----C
hsa-mir-944      AAGAGAAAUUAUUGUACAUCGGAUGAGCUGU-GUCUGGGAUUA--------AGUAU
CONS STRUCTURE   ......))))))))))))))))))))))))..........................



Consensus
CPU time: 0.00
Average sequence ID: 0.229233694063
Average free energy: -29.3030434783
Average covariation: 1.12574110672
Average basepair probability: 0.879188461562
Canonical basepairs: NA

Sequence and structure consensus for Consensus
MAWVKBUUMHCDSDwGRMSWGVKUKKGGSWWMYKYYGWMSRKRBByUSYURRKSRRAMMyMMRCRVRMRYRWWSRRCRBWRSHMVWAMBC HKUSYSMVGMWuryyuVYMYYMUYVY
....................((((((((((((((((((((((((......................)))))))))))))))))))))))) ..........................

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table