Results

You can download the results in the following formats: fasta clustal stockholm col
The consensus is based on:
CMfinder   FoldalignM   LaRA   MASTR   RNAalifold   RNAforester   RNASampler  


T-coffee consensus alignment

BAD AVG GOOD
hsa-mir-516b-1   GAA-UAUCUCAGGCUGUGACCAUCUGGAGGUAAGAAGCACUUUCUGUUUUGUGAAAGAAA
hsa-mir-516b-2   GAA-GA-UCUCAUGAUGUGACCAUCUGGAGGUAAG-AAGCACUUUGU-GUUUUGUGAAAG
hsa-mir-517a     AGAAGA-UCUCAGGCAGUGACCCUCUAGAUGGAA--GCACUGUCUGUUGUAUAAAAGAAA
hsa-mir-517b     AGAAGACCUCAUGCU-GUGACCCUCUAGAUGGAA--GCACUGUCUGUUG-UCUAAGA-AA
hsa-mir-517c     AGAAGA-UCUCAGGCAGUGACCCUCUAGAUGGAA--GCACUGUCUGUUG-UCUAAGA-AA
hsa-mir-518b     AAGAAUAUGUCAUGCUGUGGCCCUCCAGAGGGAA--GCGCUUUCUGUUGUCUGAAAGAAA
hsa-mir-518c     AGAAGA-UCUCAUGCUGUGACUCUCUGGAGGGAA--GCACUUUCUGUUGUCUGAAAGAAA
hsa-mir-518e     CAA-GA-UCUCAGGCUGUGACCCUCUAGAGGGAA--GCGCUUUCUGUUGGCUAAAAGAAA
hsa-mir-518f     GAA-GA-UCUCAUGCUGUGACCCUCUAGAGGGAA--GCACUUUCUCUUGUCUAAAAGAAA
hsa-mir-519a-1   GAA-GACCUCAGGCUGUGACACUCUAGAGGGAAG--CGCUUUCU-GUUGUCUGAAAGA-A
hsa-mir-519a-2   AGAAGA-UCUCAGGCUGUGUCCCUCUACAGGGAA--GCGCUUUCUGUUGUCUGAAAGAAA
hsa-mir-519d     AGAAGAUCCCAUGCUGUGACCCUCCAAAGGGAAG--CGCUUUCUGUUUGUUUUCUCUUAA
hsa-mir-519e     GAGAAGAUCUCAUGCAGUCAUUCUCCAAAAGGGA--GCACUUUCUGU--UU-GAAAGAAA
hsa-mir-520b     AAGAAGAUGUCAGGCUGUGUCCCUCUACAGGGAA--GCGCUUUCUGUUGUCUGAAAGAAA
hsa-mir-520e     AAGACUGUCUCCUGCUGUGACCCUCAAGAUGGAA--GCAGUUUCUGUUGUCUGAAAGGAA
hsa-mir-520f     GAG-GA-UCUCAGGCUGUGACCCUCUAAAGGGAA--GCGCUUUCUGUGGUCAGAAAGAAA
hsa-mir-520g     AGAU-CCCAUGCUGUGACCCUCUAGAG-GAAGCAC-UUUCUGUUUGUUGUCU--GAGAAA
hsa-mir-520h     GAAGAUCCCAUGCUGUGACCCUCUAGAGG-AAGCACUUUCUGUUUGUUGUCU--GAGAAA
hsa-mir-521-1    AGAAGA-UCUCAGGCUGUGACCCUCCAAAGGGAA--GAACUUUCUGUUGUCUAAAAGAAA
hsa-mir-521-2    AGAAGG-UCUCGGGCUGUGACUCUCCAAAGGGAA--GAAUUUUCUCUUGUCUAAAAGAAA
hsa-mir-522      GAA-GA-UCUCAGGCUGUGUCCCUCUAGAGGGAA--GCGCUUUCUGUUGUCUGAAAGAAA
hsa-mir-523      GAA-GA-UCUCAUGCUGUGACCCUCUAGAGGGAA--GCGCUUUCUGUUGUCUGAAAGAAA
hsa-mir-526a-1   GAA-GAGCUCAGGCUGUGACCCUCUAGAGGGAAG--CACUUUCU-GUUGCUU-GAAAGAA
hsa-mir-526a-2   GAA-GA--UCUCGUGCUGUGACCCUCUAGAGGGAA--GCACUUUC-U-GUUGAAAGAAAA
hsa-mir-526b     GAAGAUGUCAGGCUGUGACCCUCUUGAGGGAAGC--ACUUUCUGU-U-GUCUGAAAGA-A
hsa-mir-527      AAGAAGAUCUCAAGCUGUGAC-UG-CAAAGGGAA--GCCCUUUCUGUUGUCUAAAAGAAA
CONS STRUCTURE   .........((((..(((((((((((((((((((..(((((((((.(..(((...))).)

hsa-mir-516b-1   AGAAAGUGCUUCC-UUUCAGAGGGUUAC-UCUUUGAG--AAAAGC-A--
hsa-mir-516b-2   AAAGUGCUU--CCUUUCAGAGGGUUACU-CUUUGAGAAAAGCAGC-AUU
hsa-mir-517a     AGAUCGUGCAUCCCUUUAGAGUGUUACUGU-UUGAGA-C--AAGCAAC-
hsa-mir-517b     AGAUCGUGCAUCCCUUUAGAGUGUUAC--UGUUUGAG-AAAAGCAACGU
hsa-mir-517c     AGAUCGUGCAUCCUUUUAGAGUGUUACUGU-UUGAGAAAAUCAAC-GU-
hsa-mir-518b     ACAAAGCGCUCCCCUUUAGAGGUUUACGGU-UUGA-G-U-AAAGC-AG-
hsa-mir-518c     ACAAAGCGCUUCUCUUUAGAGUGUUACGGU-UUGAGA---AAAGCAAC-
hsa-mir-518e     AGAAAGCGCUUCCCUUCAGAGUGUUAACGCUUUGAGA---AAAGCAAC-
hsa-mir-518f     AGAAAGCGCUUCUCUUUAGAGGAUUAC-UCUUUGAGA---AAAGCAACG
hsa-mir-519a-1   AGGAAAGUGCAUCCUUUUAGAGUGUUAC-UGUUUGAG--AAAAGCAACA
hsa-mir-519a-2   GGAAAGUGCAUCCUUUUAGAGUGUUACUGU-UUGAGA---AAAGCAAC-
hsa-mir-519d     A-CAAAGUGCCUCCCUUUAGAGUGUUACCG-UUUGGG--AAAAGC--CA
hsa-mir-519e     ACAAAGUGCCUCCUUUUAGAGUGUUACUGU-UUGAGA--AAAACCACGU
hsa-mir-520b     AGAAAGUGCUUCCUUUUAGAGGGUUACCGU-UU---AAGAAAAGCAA--
hsa-mir-520e     AGAAAGUGCUUCCUUUUUGAGGGUUACUG-UUUGAGA---AAAGCAA--
hsa-mir-520f     AGCAAGUGCUUCCUUUUAGAGGGUUACCGU-UUGGGA---AAAGCAAUG
hsa-mir-520g     AAACA-AAGUGCUUCCCUUUAGAGUGUUA-CCGUUUGGGAAAAGCAG-U
hsa-mir-520h     AAACAAAGUGCUUCCCUUUAGA--GUUAC-UGUUUGG-GAAAAGCAG-U
hsa-mir-521-1    AGAACGCACUUCCCUUUAGAGUGUUACCGU-GUGAGA---AAAGCAAC-
hsa-mir-521-2    AGAACGCACUUCCCUUUAGAGUGUUACCGU-GUGAGA---AAAGCAAU-
hsa-mir-522      AGAAAAUGGUUCCCUUUAGAGUGUUACG-CUUUGAGA---AAAGCAUCG
hsa-mir-523      AGAACGCGCUUCCCUAUAGAGGGUUACCC-UUUGAGA---AAAGCAGCA
hsa-mir-526a-1   GAGAAAGCGCUUCCUUUUAGAGGAUUAC-UCUUUGAG-AAAAA-CAACA
hsa-mir-526a-2   GAACAUGCAUCCUUUCAGAGGGUUACUC-UUUGAGAAGAGCAACGUUUA
hsa-mir-526b     G-AGAAAGUGCUUCCUUUUAGAGGCUUAC-UGUCUGA-GAAAAGCAACG
hsa-mir-527      AGAAAGUGCUUCCCUUUGGUGAAUUACGGU-UUGAGA---AAAGCAACG
CONS STRUCTURE   ))))))))))))))))))))))))))))...))))..............



Consensus
CPU time: 0.00
Average sequence ID: 0.542926416031
Average free energy: -26.9730769231
Average covariation: 0.353867521368
Average basepair probability: 0.742850019199
Canonical basepairs: 0.860664523044

Sequence and structure consensus for Consensus
RRAAGAMYCYCAKSCUGUGMCCCYCYARRGGGAAmmGCVCUUUYUGUUGUYURAAAGAAAAGAAMGYGCUYCCYUUUWGAGKGUUACYSY YUUKRGRrrAAAAGCAACD
.........((((..(((((((((((((((((((..(((((((((.(..(((...))).))))))))))))))))))))))))))))).. .))))..............

The alignment colored using colorrna.pl of the Vienna package

Cluster tree of the methods














Please send any comments or report bugs to Elfar Torarinsson or Stinus Lindgreen
Table